Molecular technique for sexing cercariae

 

Author             Tori C. Freitas, Sarah Galanti, and Edward J. Pearce

 

Introduction

Snails infected with a single miracidium will release a clonal population of cercariae upon becoming patent.  Because the sex of the parasite is determined at the egg stage, all cercariae shedding from a snail infected with a single miracidium will be either male or female.  This procedure describes the molecular technique for sexing cercariae isolated from single miracidium-infected snails using PCR.  Primers are designed to amplify the repetitive W1 sequence found only in females of the Puerto Rican strain.  Sex is determined based on the presence (female) or absence (male) of the 473bp product.  We have had better luck with genomic DNA isolated by phenol:chloroform extraction (below) rather than from various DNA isolation kits.

 

Equipment

Thermal Cycler

Microcentrifuge (refridgerated is preferable)

Heat Block

DNA gel running apparatus and UV transilluminator

 

Materials and Reagents

Lysis Buffer (100mM NaCl, 10mM Tris pH8, 25mM EDTA, pH8, 0.5% SDS, 0.1mg/ml proteinase K)

Phenol:Chloroform:Isoamyl alcohol (25:24:1)

Chloroform

Isopropanol

70% Ethanol

24 well plates (clean, but non-sterile will work)

1.5 ml microfuge tubes

PCR tubes

PCR reagents

Agarose gel reagents

Aged tap water

 

Procedure

• Shed each snail in about 1 ml of aged tap water in an individual well of a 24 well plate by exposing to light for 45 minutes to 1 hour.  Note, approximately 30% of single miracidium infected snails will become patent.
• Transfer shed cercariae to 1.5 ml microfuge tubes.  Putting the tubes on ice at this point will aid in the pelleting of the cercariae.
• Spin at max speed at 4°C in a microcentrifuge for 5 minutes, remove water, leaving the pelleted cercariae behind.
• Pellets can be frozen at -80°C or processed immediately.
• Add 200 ml of lysis buffer to each tube and incubate at 50°C for 2 hours.  Invert tubes occasionally (2-3 times per hour).  Material may become viscous if starting with large numbers of cercariae.
• Add 1 volume (200ml) of phenol:chloroform:isoamyl alcohol and mix by vigorous shaking for 15-30 seconds (do not vortex).
• Spin at max speed at 4°C in a microcentrifuge for 5 minutes.
• Carefully transfer the aqueous (top) layer into a new tube, being sure to leave all phenol:chloroform and degraded material behind.
• Add 1 volume (200 ml) of chloroform and mix by vigorous shaking for 15-30 seconds (do not vortex).
• Spin at max speed at 4°C in a microcentrifuge for 5 minutes.
• Transfer aqueous (top) layer into a new tube and add 1 volume (200 ml) of isopropanol.  Allow for better DNA precipitation by incubating at -20°C for at least 1 hour (overnight at -20°C works well).
• Spin at 4°C at max speed in a microcentrifuge for 10 minutes.
• Aspirate liquid, being careful to not dislodge pelleted DNA (it may be difficult to see depending on how much parasite material you started with).
• Wash pellets with 70% ethanol.  You may need to re-spin the tubes if the pellets have dislodged.  Remove as much ethanol as possible and allow the pellets to air dry.
• Resuspend in 30-50 ml of 10mM Tris, pH 8.
• Determine DNA concentration by reading on a spectrophotometer.

 

 

W1 Primer sequences:

      FW 5’ – CAACACAGTGAAATTCTTC – 3’

      RV 5’ – GAATTCACCACTCGACATTC – 3’

 

Positive control primers:

-      Any S. mansoni specific primer set will do.  Just be sure to double check the size of the amplicon if the primers were originally designed to amplify a cDNA product, (ie., does the primer pair span an intron?).  This product will verify the integrity of the DNA used as template.  If the W1 product is not amplified, yet you amplify a product using your postive control primers, the cercariae from that sample are male.

 

PCR:

      Any PCR should work.  We use Invitrogen’s recombinant taq polymerase, (Cat. No. 10342-020) (see reaction below):

 

      5ml     10X Buffer

      1.5ml  50mM MgCl₂

      1ml     10mM dNTP

      1ml     FW Primer (10mM)

      1ml     RV Primer (10mM)

      0.2ml Taq polymerase

      Yml    genomic DNA (100-200ng)

      Xml    Water

      50ml   Total

 

Thermal Cycler Program:

 

      1.         94°C     2 minutes

      2.         94°C     30 seconds

      3.         60°C     30 seconds

      4.         72°C     1 minute

      5.         72°C     5 minutes

      6.         4°C       hold

 

40 cycles of steps 2 through 4.

 

Run on a ~1.5% ethidium bromide stained agarose gel, visualize via UV transillumination.  Batches of cercariae showing a band at 473bp with the W1 primers are female.  Those without a band at 473bp (but HAVE the positive control band) are male.  Those without either band are inconclusive and should be repeated.  Most likely cause of a failed PCR is not enough genomic DNA as template.

 

References

Webster, P., Mansour, T.E., and Bieber, D. 1989. Isolation of a female specific, highly repeated Schistosoma mansoni. Molecular and Biochemical Parasitology 36: 217–222.

 

Gasser, R.B., Morahan, G., and Mitchell, G.F. 1991. Sexing single larval stages of Schistosoma mansoni by polymerase chain reaction. Molecular and Biochemical Parasitology 47: 255–258.

 

Grevelding, C.G. 1995. The female-specific W1 sequence of the Puerto Rican strain of Schistosoma mansoni. Molecular Biochemical Parasitology 71: 269–272.